View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7676_low_7 (Length: 263)
Name: NF7676_low_7
Description: NF7676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7676_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 72 - 253
Target Start/End: Complemental strand, 35128393 - 35128211
Alignment:
| Q |
72 |
ctatggactctctataagatacttggagttgatcaaatccatccttttcaaacaaggaagatcttgtaaagagaattaggaaccatcagtaaagatgtcc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35128393 |
ctatggactctctataagatacttggagttgatcaaatccatccttttcaaacaaggaagatcttgtaaagagaattaggaaccatcagtaaagatgtcc |
35128294 |
T |
|
| Q |
172 |
cact-aaatttaggattaatatgtaacttgttgcataattaggattattctcactatttattatcgttgatatattttatatt |
253 |
Q |
| |
|
|| | ||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35128293 |
caataaaatttaggattattatgtaacttgttacataattaggattattctcactatttattatcgtatatatattttatatt |
35128211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 75 - 172
Target Start/End: Original strand, 35042775 - 35042871
Alignment:
| Q |
75 |
tggactctctataagatacttggagttgatcaaatccatccttttcaaacaaggaagatcttgtaaagagaattaggaaccatcagtaaagatgtccc |
172 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||| |||| ||||| ||||||||||||| | |||||||||||||||| |||| |
|
|
| T |
35042775 |
tggagtctctataagatacttggagttgctcaaatccatccttttcaaataagggagatcctgtaaagagaatt-gcaaccatcagtaaagatatccc |
35042871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 20 - 63
Target Start/End: Complemental strand, 35128538 - 35128495
Alignment:
| Q |
20 |
tacaaaaatcgaggtcgaccaaactgctgctgttttgtaaattt |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35128538 |
tacaaaaatcgaggtcgaccaaactgctgctgttttgtaaattt |
35128495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 134
Target Start/End: Original strand, 35102855 - 35102914
Alignment:
| Q |
75 |
tggactctctataagatacttggagttgatcaaatccatccttttcaaacaaggaagatc |
134 |
Q |
| |
|
|||| ||||| ||||| ||||||||||| |||||||||||||||||||| |||| ||||| |
|
|
| T |
35102855 |
tggagtctctgtaagaaacttggagttgctcaaatccatccttttcaaataagggagatc |
35102914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University