View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7677_low_13 (Length: 328)
Name: NF7677_low_13
Description: NF7677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7677_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 8452064 - 8451754
Alignment:
| Q |
1 |
tcaatatgttcgagcccggcttgatacggttgtgaagaagaatggccttcaacttgtatgccctcctccccggctttgtaccgacaatggtaataattta |
100 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8452064 |
tcaatatgttcgggcccggcttgatacagttgtgaagaagaatggccttcaacttgtatgccctcctccccggctttgtaccgacaatggtaatagttta |
8451965 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnnnnnnaataatgacggctaactct--atgttgtgctctttgcaaactttacatagctgatcccaagtcttcatagaagagtataaaac |
198 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8451964 |
ttttttgttttgcttttaataatgacggctaactctctatgttgtgctctttgcaaactttacatagctgatcccaagtcttcatagaagagtataaaac |
8451865 |
T |
 |
| Q |
199 |
cttgaacaatctgttgttatattaaagtttatatcttaatggactgg-ttttttaactgaataggtgtaatggttgcttggactggtattgagcactttc |
297 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8451864 |
c-tgaacaatctgttgttatattaaagtttatatcttaatggactggtttttttaactgaataggtgtaatggttgcttggactggtattgaacactttc |
8451766 |
T |
 |
| Q |
298 |
gcgtgggaagat |
309 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8451765 |
gcgtgggaagat |
8451754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University