View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7677_low_15 (Length: 264)
Name: NF7677_low_15
Description: NF7677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7677_low_15 |
 | |
|
| [»] scaffold0003 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 24494656 - 24494908
Alignment:
| Q |
1 |
gtttcatggacttcacttgaagcacacttcttctcaaaatctttatgcattcagtgatgccgattgggctggaaatagagatgattatacatccacctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24494656 |
gtttcatggacttcacttgaagcacacttcttctcaaaatctttatgcattcagtgatgccgattgggctggaaatagagatgattatacatccacctct |
24494755 |
T |
|
| Q |
101 |
gcacatgttacattttatggtggtaacccaatttcttggaagtcttttaaacaaaaagccgttgcaagatcatccactgaagctgaatatagagctctag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24494756 |
gcacatgttacattttatggtggtaacccaatttcttggaagtcttttaaacaaaaagccgttgcaagatcatccactgaagctgaatatagagctctag |
24494855 |
T |
|
| Q |
201 |
catccgcatctgcagaagttctctggttgtcatcacttctctctgaacttcat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24494856 |
catccgcatctgcagaagttctctggttgtcatcacttctctctgaacttcat |
24494908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 117 - 253
Target Start/End: Original strand, 86237 - 86373
Alignment:
| Q |
117 |
atggtggtaacccaatttcttggaagtcttttaaacaaaaagccgttgcaagatcatccactgaagctgaatatagagctctagcatccgcatctgcaga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||| ||||| |
|
|
| T |
86237 |
atggtggtaacccaatttcttggaagtcttttaaacaaaaatttgttgcaagatcatccactgaagctgaatacagagctctagcatacgcatccgcaga |
86336 |
T |
|
| Q |
217 |
agttctctggttgtcatcacttctctctgaacttcat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
86337 |
agttctctggttgtcatcacttctctctgaacttcat |
86373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 94006 - 94126
Alignment:
| Q |
1 |
gtttcatggacttcacttgaagcacacttcttctcaaaatctttatgcattcagtgatgccgattgggctggaaatagagatgattatacatccacctct |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
94006 |
gtttcatggacttcacttgaagtgcacttcttctcaaaatctatatgcattcagtgatgccgattgggctggaaatcgagatgattatacatccacctct |
94105 |
T |
|
| Q |
101 |
gcacatgttacattttatggt |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
94106 |
gcacatgttacattttatggt |
94126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 206 - 253
Target Start/End: Complemental strand, 18557131 - 18557084
Alignment:
| Q |
206 |
gcatctgcagaagttctctggttgtcatcacttctctctgaacttcat |
253 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18557131 |
gcatccgcagaagttctctggttgtcatcacttctctctgaacttcat |
18557084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University