View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7677_low_17 (Length: 242)

Name: NF7677_low_17
Description: NF7677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7677_low_17
NF7677_low_17
[»] chr2 (1 HSPs)
chr2 (134-213)||(33558860-33558938)


Alignment Details
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 134 - 213
Target Start/End: Complemental strand, 33558938 - 33558860
Alignment:
134 ttttggataataaaagaatatcataaccctaattgttcataaaagtcacataaccaactcttatgaactaccaaggtatg 213  Q
    |||||| |||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||    
33558938 ttttgggtaataaaaaaatatcataaccctaattgttcataaaagtcacatca-caactcttatgaactaccaaagtatg 33558860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University