View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7677_low_18 (Length: 231)
Name: NF7677_low_18
Description: NF7677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7677_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 41459404 - 41459610
Alignment:
| Q |
14 |
catcatcaccaacacgttagtaggaaataatggatatgcagctcctgaatatgtagattcaggtattttccggttcatgttcccgaaccatatttttgtt |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41459404 |
catcttcaccaacacgttagtaggaaataatggatatgcagctcctgaatatgtagattcaggtattttccggttcatgttcccgaaccatatttttgtt |
41459503 |
T |
 |
| Q |
114 |
tcgcgtttctccttttctgannnnnnnatgttattctagattcagcttagttgtcttgcttaagactaatttatctttattctttgcgagccttgaatat |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41459504 |
tcgcgtttctccttttctgatttttttatgttattctagattcagcttagttgtcttgcttaagactaatttatctttattctttgcgagccttgaattt |
41459603 |
T |
 |
| Q |
214 |
tcttcga |
220 |
Q |
| |
|
| ||||| |
|
|
| T |
41459604 |
ttttcga |
41459610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University