View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7677_low_23 (Length: 203)
Name: NF7677_low_23
Description: NF7677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7677_low_23 |
 |  |
|
| [»] scaffold0318 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0318 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: scaffold0318
Description:
Target: scaffold0318; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 7 - 185
Target Start/End: Original strand, 5401 - 5579
Alignment:
| Q |
7 |
tcgagagagatgaaaagaatatgctttcaatacaaaggtaaaaacatcgtcgtctagagtattgtggtgtatatctaatatcttcattcttcaattttgc |
106 |
Q |
| |
|
|||||||| || |||||||||| |||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5401 |
tcgagagaaataaaaagaatatactttcaatacaaaggtaagaacatcgtc---taaagtattgtggtgtatatctaatatcttcattcttcaattttgc |
5497 |
T |
 |
| Q |
107 |
tcattaatctttgatactttgggaccattttatta---aagtgtgagatgttcatgtccactcaaagtggaacagaggtgaa |
185 |
Q |
| |
|
||||||||||||| || |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5498 |
tcattaatctttgttagtttgggaccattttattaaagaagtgtgagatgttcatgtccactcaaagtggaacagaggtgaa |
5579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University