View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7680_high_38 (Length: 240)
Name: NF7680_high_38
Description: NF7680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7680_high_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 33 - 224
Target Start/End: Original strand, 28273962 - 28274153
Alignment:
| Q |
33 |
ttgaggttgtattgatcaattaataatcgttgtggatgggaaattctgacaaattattatattttatttgtgttgcaaaaaattgtttatgctgaacaag |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
28273962 |
ttgaggttgtattgatcaattaataatcgttgtggatgggaaattctgacaaattattatattttatttgggttggaaaaaattgtttatgctgaacaag |
28274061 |
T |
|
| Q |
133 |
ttatgggtaataataaacagaaactagttaagatggtggtctatactatagtggtgttgaggaatgtgtattgattgattaaataagaaaac |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28274062 |
ttatgggtaataataaacagaaactagttaagatggtggtctatactatagtggtgttgaggaatgtgtattgattgattaaataagaaaac |
28274153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University