View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7680_high_44 (Length: 226)
Name: NF7680_high_44
Description: NF7680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7680_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 97 - 184
Target Start/End: Original strand, 49445799 - 49445886
Alignment:
| Q |
97 |
ttactttggcttctcgggatcaagttactgctagcagcccatcaaacagtttggtaaagtgtcctgtacaagatgataaacgtaacag |
184 |
Q |
| |
|
|||||||||||||||| |||||| | |||||||||||| ||| ||||| ||||| || ||||||||||||||||||| ||| |||||| |
|
|
| T |
49445799 |
ttactttggcttctcgtgatcaattgactgctagcagcacattaaacattttggcaaggtgtcctgtacaagatgatgaacttaacag |
49445886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 97 - 169
Target Start/End: Original strand, 55709717 - 55709789
Alignment:
| Q |
97 |
ttactttggcttctcgggatcaagttactgctagcagcccatcaaacagtttggtaaagtgtcctgtacaaga |
169 |
Q |
| |
|
||||| ||||||||||||||||| | ||||| |||||| ||| ||||| ||||| || ||||||||||||||| |
|
|
| T |
55709717 |
ttactctggcttctcgggatcaattgactgccagcagcacattaaacattttggcaaggtgtcctgtacaaga |
55709789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 182 - 221
Target Start/End: Original strand, 49445919 - 49445958
Alignment:
| Q |
182 |
cagaactcatatctcattgtctagctacaatgctcatgat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49445919 |
cagaactcatatctcattgtctagctacactgctcatgat |
49445958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University