View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7680_high_46 (Length: 217)
Name: NF7680_high_46
Description: NF7680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7680_high_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 87 - 204
Target Start/End: Original strand, 22777284 - 22777401
Alignment:
| Q |
87 |
cttcagattcttcgagtttctttcagattgttgggttaataattttgcttccaagtgttggaatggagaaacacggtggttggaagggcgttcaatctca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||||| | ||||| |||||||| |||||| |||||||||||| |
|
|
| T |
22777284 |
cttcagattcttcgagtttctttcagattgttgggttaatagttttgtttccaggtgttggaacgaagaaagacggtggtgggaaggacgttcaatctca |
22777383 |
T |
|
| Q |
187 |
gaattgttcggatcacag |
204 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
22777384 |
gaattgttcggatcacag |
22777401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University