View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7680_high_47 (Length: 213)
Name: NF7680_high_47
Description: NF7680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7680_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 23 - 190
Target Start/End: Original strand, 15514122 - 15514289
Alignment:
| Q |
23 |
gtatggtgttatgtggtgctggatttgtctccggctgcttcttcttcctcattgcgctttgcaatgtcattcttatcaaacttgactatggttttcgtgt |
122 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
15514122 |
gtatgctgttatgtggtgctggatttgtctccggctgcttcttcttcctcattgcgctttgcaatgtcattcttatcaaacttggctatggttttcgtat |
15514221 |
T |
 |
| Q |
123 |
cttggtccttgcggttccacttgttcgggtcattactgtttcccttttcaagtacgtaagggtctact |
190 |
Q |
| |
|
|||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15514222 |
cttgtttcttgcagttccacttgttcgggtcattactgtttcccttttcaagtacgtaagggtctact |
15514289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University