View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7680_high_49 (Length: 207)
Name: NF7680_high_49
Description: NF7680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7680_high_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 15 - 167
Target Start/End: Original strand, 33178218 - 33178370
Alignment:
| Q |
15 |
atgaatatcaagcaggtgtggagcaattggacaacattaatccccctgctaacttcacttcaccgctgtgtactttgaagaaaatcaattctgaggtctt |
114 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33178218 |
atgaatatcaagcaagtgtggagcaattggacaacattaatccccctgctaacttcacttcaccgctgtgtactttgaagaaaatcaattctgaggtctt |
33178317 |
T |
|
| Q |
115 |
tatcttaatatttcatttccatatgctagttaaaagtttagaaaagtagaaag |
167 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
33178318 |
tatcttaatatttcatttccatatgctagctaaaagtttagaaaagtataaag |
33178370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 33 - 142
Target Start/End: Original strand, 33155442 - 33155550
Alignment:
| Q |
33 |
tggagcaattggacaacattaatccccctgctaacttcacttcaccgctgtgtactttgaagaaaatcaattctgaggtctttatcttaatatttcattt |
132 |
Q |
| |
|
||||||| || || |||||||| |||||||| | ||||||||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
33155442 |
tggagcagttagataacattaacccccctgccagcttcacttcaccgttgtgtactttgaagaaaatcaattctgaggtc-ttattttaatatttcattt |
33155540 |
T |
|
| Q |
133 |
ccatatgcta |
142 |
Q |
| |
|
||||||||| |
|
|
| T |
33155541 |
tcatatgcta |
33155550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 21 - 132
Target Start/End: Complemental strand, 33290165 - 33290054
Alignment:
| Q |
21 |
atcaagcaggtgtggagcaattggacaacattaatccccctgctaacttcacttcaccgctgtgtactttgaagaaaatcaattctgaggtctttatctt |
120 |
Q |
| |
|
|||||| |||| |||||| |||||| |||| |||||||||||| ||||||| ||||| |||||| |||||||||||| ||||||||||||||||| || |
|
|
| T |
33290165 |
atcaaggaggtctggagccattggataacacacatccccctgctagcttcactccaccgttgtgtattttgaagaaaattaattctgaggtctttatttt |
33290066 |
T |
|
| Q |
121 |
aatatttcattt |
132 |
Q |
| |
|
||||||| |||| |
|
|
| T |
33290065 |
aatattttattt |
33290054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 21 - 99
Target Start/End: Original strand, 33137709 - 33137787
Alignment:
| Q |
21 |
atcaagcaggtgtggagcaattggacaacattaatccccctgctaacttcacttcaccgctgtgtactttgaagaaaat |
99 |
Q |
| |
|
|||||| |||| ||||||| |||| || |||||||| || |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
33137709 |
atcaaggaggtttggagcacctggataatattaatccaccagctagcttcacttcaccgctgtgtactttgaagcaaat |
33137787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University