View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7680_low_12 (Length: 489)
Name: NF7680_low_12
Description: NF7680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7680_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 24 - 400
Target Start/End: Complemental strand, 471740 - 471363
Alignment:
| Q |
24 |
acctcggtataaagttgggagatgaagatggaagaattaaacttttaattatttttagcaaattcaaaagaaagagaggaataaaatggaaattatttga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
471740 |
acctcggtataaagttgggagatgaagatggaagaattaaacttttaattatttttagcaaattcaaaagaaagagaggaataaaatggaaattatttga |
471641 |
T |
 |
| Q |
124 |
tgttgtaagtgcatcataaactcttatgtacttctcaaattcaactcttaatcatcaatcttaaatgg-nnnnnnnnnncttctacaatatttcgttttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||| |
|
|
| T |
471640 |
tgttgtaagtgcatcataaactcttatgtacttctcaaattcaactcttaatcatcaatcctaaatggtttttttttttcttctacaatatttcgtattt |
471541 |
T |
 |
| Q |
223 |
tagtacaagtgaatgattgtctttatatgtacaaattacaaatacaaataacaaaccnnnnnnnnnnnnncaagcaaccgattttagttttttagcgaaa |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
471540 |
tagtacaagtgaatgattgtctttatatgtacaaattacaaatacaaataacaaaccaaaacaagaataacaagcagccgattttagttttttagcgaaa |
471441 |
T |
 |
| Q |
323 |
gaaactccaccttctctataannnnnnnnnnnatcttttactcattgaagacggtgattttaggtcatcatatgcatc |
400 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
471440 |
gaaactccaccttctctatattttttttttttatcttttactcattgaagacggtgattttaggtcatcatctgcatc |
471363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University