View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7680_low_16 (Length: 402)
Name: NF7680_low_16
Description: NF7680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7680_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 8e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 304 - 395
Target Start/End: Complemental strand, 31835755 - 31835664
Alignment:
| Q |
304 |
aaggaaggacaattcaaggttcacaatgtacagcagctttaatgttatatctaggatagtaggattacattttgaatcttcagttcttctca |
395 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31835755 |
aaggaaggacaatacaaggttcacaatgtacagcagctttaatgttatatctaggatagtaggattacattttgaatcttctgttcttctca |
31835664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 19 - 130
Target Start/End: Complemental strand, 31836135 - 31836008
Alignment:
| Q |
19 |
ggtgtttcattggtaattagttacaaaggaaatgatgaaagtcaagtcaagtgtggtatacta----------------ggattggatgagtgtagtttt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31836135 |
ggtgtttcattggtaattagttacaaaggaaatgatgaaagtcaagtcaagtgtggtatactaagatattgttagacagggattggatgagtgtagtttt |
31836036 |
T |
 |
| Q |
103 |
atctgttcttatgagaagctgaccagga |
130 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31836035 |
atctgttcttatgagaagctgaccagga |
31836008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University