View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7680_low_26 (Length: 300)
Name: NF7680_low_26
Description: NF7680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7680_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 15 - 163
Target Start/End: Complemental strand, 2926306 - 2926158
Alignment:
| Q |
15 |
tatgaagtacaggtggtttcgcctcgtaactattttgcattcactcctttgcttcctagcgtcacttgcggcaccgttgaagcgcgtagcattgttgaac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2926306 |
tatgaagtacaggtggtttcgcctcgtaactattttgcattcactcctttgcttcctagcgtcacttgcggcactgttgaagcgcgtagcattgttgaac |
2926207 |
T |
 |
| Q |
115 |
ctgttcgcaatatttttaggaaggtaataaaatgtttaattgctgagaa |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2926206 |
ctgttcgcaatatttttaggaaggtaataaaatgtttaattgctgagaa |
2926158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 218 - 294
Target Start/End: Complemental strand, 2926103 - 2926028
Alignment:
| Q |
218 |
aaaacttatactgtatacagctgtgatcagtgttcacatacacaggagatgcatgtatacaaatattttacatgtac |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2926103 |
aaaacttatactgtatacagctgtgatcagtgttcacatacaca-cagatgcatgtatacaaatattttacatgtac |
2926028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University