View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7680_low_31 (Length: 251)
Name: NF7680_low_31
Description: NF7680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7680_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 234
Target Start/End: Complemental strand, 44476581 - 44476363
Alignment:
| Q |
16 |
atttcgaattcttatcaaacactcatcaaactgctaataaaactagcaatgttcttcccatttctcaaggcgaagaattacaaaccttgcttagtgctgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44476581 |
atttcgaattcttatcaaacactcatcaaactgctaataaaactagcaatgttcttcccatttctcaaggcgaagaattacaaaccttgcttagtgctgt |
44476482 |
T |
|
| Q |
116 |
tttaacaaaccaacaaacttgtttagatggtttagttactgcatcttctgatcaaacggtgattaatgatttttcatcaacaatttccgatgatacaaag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44476481 |
tttaacaaaccaacaaacttgtttagatggtttagttactgcatcttctgatcaaacggtgattaatgatttttcatcaacaatttccgatgatacaaag |
44476382 |
T |
|
| Q |
216 |
attcatagtgtgtcccttg |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44476381 |
attcatagtgtgtcccttg |
44476363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 96 - 148
Target Start/End: Complemental strand, 37166677 - 37166625
Alignment:
| Q |
96 |
caaaccttgcttagtgctgttttaacaaaccaacaaacttgtttagatggttt |
148 |
Q |
| |
|
||||| |||||||||||||||||||| || || ||||| |||||||||||||| |
|
|
| T |
37166677 |
caaacattgcttagtgctgttttaactaatcatcaaacatgtttagatggttt |
37166625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University