View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7680_low_35 (Length: 245)
Name: NF7680_low_35
Description: NF7680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7680_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 237
Target Start/End: Original strand, 15513717 - 15513945
Alignment:
| Q |
9 |
atggacatcatgtcatgtcgaccaaactttcttccttcctctacatatatcacctctctacacaactttttcataatcagcaaataatctaagtgaaatt |
108 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
15513717 |
atggacctcatgtcatatcgaccaaactttcttccttcctctacatatatcacctctctacacaactttttaataatcagcaaataatccaagtgaaatt |
15513816 |
T |
 |
| Q |
109 |
actacgtatattctctctatctcaagcaagctccatggccaataattaccccattgatcagatcaacgccttatataagatggggaagataaactccctc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15513817 |
actacgtatattctctctatctcaagcaagctccatggccaataattaccccattgatcagatcaacgccttatataagatggggaagataaactccctc |
15513916 |
T |
 |
| Q |
209 |
tttggattggcaacatgtcttttattgat |
237 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
15513917 |
tttggattggcaacatgtcttttcttgat |
15513945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University