View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7680_low_44 (Length: 226)

Name: NF7680_low_44
Description: NF7680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7680_low_44
NF7680_low_44
[»] chr4 (3 HSPs)
chr4 (97-184)||(49445799-49445886)
chr4 (97-169)||(55709717-55709789)
chr4 (182-221)||(49445919-49445958)


Alignment Details
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 97 - 184
Target Start/End: Original strand, 49445799 - 49445886
Alignment:
97 ttactttggcttctcgggatcaagttactgctagcagcccatcaaacagtttggtaaagtgtcctgtacaagatgataaacgtaacag 184  Q
    |||||||||||||||| |||||| | |||||||||||| ||| ||||| ||||| || ||||||||||||||||||| ||| ||||||    
49445799 ttactttggcttctcgtgatcaattgactgctagcagcacattaaacattttggcaaggtgtcctgtacaagatgatgaacttaacag 49445886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 97 - 169
Target Start/End: Original strand, 55709717 - 55709789
Alignment:
97 ttactttggcttctcgggatcaagttactgctagcagcccatcaaacagtttggtaaagtgtcctgtacaaga 169  Q
    ||||| ||||||||||||||||| | ||||| |||||| ||| ||||| ||||| || |||||||||||||||    
55709717 ttactctggcttctcgggatcaattgactgccagcagcacattaaacattttggcaaggtgtcctgtacaaga 55709789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 182 - 221
Target Start/End: Original strand, 49445919 - 49445958
Alignment:
182 cagaactcatatctcattgtctagctacaatgctcatgat 221  Q
    ||||||||||||||||||||||||||||| ||||||||||    
49445919 cagaactcatatctcattgtctagctacactgctcatgat 49445958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University