View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7681_high_5 (Length: 242)
Name: NF7681_high_5
Description: NF7681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7681_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 23 - 229
Target Start/End: Original strand, 39075419 - 39075624
Alignment:
| Q |
23 |
ttacacccaaccataaattattttcatgttttgtctaacacgtcgttggagaaagaatatgcttacaaaattatatcacaatgagcacaaacatcgactc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39075419 |
ttacacccaaccataaattattttcatgttttgtctaacacgtcgttggagaaagaatatgcttacaaaattatatcacaatgagcacaaacatcgactg |
39075518 |
T |
 |
| Q |
123 |
aacaaacacgtcnnnnnnnnnnnnnnaagaaaattgagttagagactataaccagtttatc--tgtgaggtactgcataaactgtctagtgaaattgaag |
220 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39075519 |
aacaaacacgtc---tttttttttttaagaaaattgagttagagactataaccagtttatctttgtgaggtactgcataaactgtctagtgaaattgaag |
39075615 |
T |
 |
| Q |
221 |
catacacag |
229 |
Q |
| |
|
||||||||| |
|
|
| T |
39075616 |
catacacag |
39075624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University