View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7681_low_4 (Length: 327)
Name: NF7681_low_4
Description: NF7681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7681_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 144 - 315
Target Start/End: Complemental strand, 35590381 - 35590210
Alignment:
| Q |
144 |
tgaagagtgtgttatgacttgtgagttctaatcagagaaagagaaagacactcaacattattaagagactcagtaacacatcatgtaccacatgatgttt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35590381 |
tgaagagtgtgttatgacttgtgagttctaatcagagaaagagaaagacactcaacattattaagagactcagtaacacatcatgtaccacatgatgttt |
35590282 |
T |
|
| Q |
244 |
taatagtattattattcacttcttgaacattaaaatcagtattaacctcaatactcttctcatcatagttct |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35590281 |
taatagtattattattcacttcttgaacattaaaatcagtattaacctcaatactcttctcatcatagttct |
35590210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 35590507 - 35590455
Alignment:
| Q |
18 |
atctatatggattaacaaaactacttttcaatttgcagaaaataagataatat |
70 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35590507 |
atctatatggattaacaaaactacatttcaatttgcagaaaataagataatat |
35590455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University