View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7682_low_10 (Length: 403)
Name: NF7682_low_10
Description: NF7682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7682_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 19 - 377
Target Start/End: Original strand, 42358306 - 42358664
Alignment:
| Q |
19 |
acaagatgcttgaaacgattaaatacctaatcggatcggcgggtccaagcgggtttggatccaaatccaccgccgaaccagtcacggaaacctgcggcga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42358306 |
acaagatgcttgaaacgattaaatacctaatcggatcggcgggtccaagcggttttggatccaaatccaccgccgaacaagtcacggaaacctgcggcga |
42358405 |
T |
 |
| Q |
119 |
tctccgctccatcaccgctatcataacaggtggtacgtcaggaattggagcagaaacggcgcgtgttttggcgaagagaggggcgagggtgattctaccg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358406 |
tctccgctccatcaccgctatcataacaggtggtacgtcaggaattggagcagaaacggcgcgtgttttggcgaagagaggggcgagggtgattctaccg |
42358505 |
T |
 |
| Q |
219 |
gcgcgtagcatgaaaaatgcggaggaaacaagaggtagaatagtgacggagtgtcctgaagcggagattatagttatggcacttgatctcagttctctca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42358506 |
gcgcgtagcatgaaaaatgcggaggaaacaagaggtagaatagtgacggagtgtcctgaagcggagattatagttatggcacttgatctcagttctgtca |
42358605 |
T |
 |
| Q |
319 |
attctgttacgaacttcgttactcgttttcattccatcggtttccctctcaatctcctc |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
42358606 |
attctgttacgaacttcgttactcgttttcactccatcggtttccctctaaatctcctc |
42358664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University