View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7682_low_20 (Length: 208)

Name: NF7682_low_20
Description: NF7682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7682_low_20
NF7682_low_20
[»] chr1 (1 HSPs)
chr1 (18-192)||(42812624-42812793)


Alignment Details
Target: chr1 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 18 - 192
Target Start/End: Original strand, 42812624 - 42812793
Alignment:
18 agaattcttcaggagttagggttccgaaggggctatgatcgttggcttctgctactgggtgcaccattttggatatcttctactatcagttagttatgtg 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||   ||     || | |||||||||    
42812624 agaattcttcaggagttagggttccgaaggggctatgatcgttggcttctgctattgggtgcaccattttggatattaact-----cactcagttatgtg 42812718  T
118 tggatatagttatagtttgagtttcggctataatcagcgtgtcccaactagttcttccacttttctccccttcat 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
42812719 tggatatagttatagtttgagtttcggctataatcagcgtgtcccaactagttcttcgacttttctccccttcat 42812793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University