View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7683_high_6 (Length: 285)
Name: NF7683_high_6
Description: NF7683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7683_high_6 |
 | |
|
| [»] scaffold0562 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0562 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: scaffold0562
Description:
Target: scaffold0562; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 154 - 380
Alignment:
| Q |
1 |
gcgtcctcatcaacaacctctctgaatcactccgcaacggcctcgcacaacgccgtccatggacagaactcgtcgaccgctccgccttcagcaaacctga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154 |
gcgtcctcatcaacaacctctctgaatcactccgcaacggcctcgcacaacgccgtccatggacagaactcgtcgaccgctccgccttcagcaaacctga |
253 |
T |
|
| Q |
101 |
atccttctccgatgccaccctccgtgtccgcaaaaactactcctacttccgtgtcaactactacgccgtcgtcgccggaatcctcgctgtctctctcctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
254 |
atccttctccgatgccaccctccgtgtccgcaaaaactactcctacttccgtgtcaactactacgccgtcgttgccggaatcctcgctgtctctctcctc |
353 |
T |
|
| Q |
201 |
accaatccattccctctcatcctcctc |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
354 |
accaatccattctctctcatcctcctc |
380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 3898905 - 3899131
Alignment:
| Q |
1 |
gcgtcctcatcaacaacctctctgaatcactccgcaacggcctcgcacaacgccgtccatggacagaactcgtcgaccgctccgccttcagcaaacctga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3898905 |
gcgtcctcatcaacaacctctctgaatcactccgcaacggcctcgcacaacgccgtccatggacagaactcgtcgaccgctccgccttcagcaaacctga |
3899004 |
T |
|
| Q |
101 |
atccttctccgatgccaccctccgtgtccgcaaaaactactcctacttccgtgtcaactactacgccgtcgtcgccggaatcctcgctgtctctctcctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3899005 |
atccttctccgatgccaccctccgtgtccgcaaaaactactcctacttccgtgtcaactactacgccgtcgttgccggaatcctcgctgtctctctcctc |
3899104 |
T |
|
| Q |
201 |
accaatccattccctctcatcctcctc |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
3899105 |
accaatccattctctctcatcctcctc |
3899131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University