View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7686_low_11 (Length: 303)
Name: NF7686_low_11
Description: NF7686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7686_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 22 - 295
Target Start/End: Original strand, 37212641 - 37212914
Alignment:
| Q |
22 |
ttagcagcgaccagtttcttccgttgtggacatcgaggaccgtagatcccggagaagaaggaagggaaaccatcggcagaggcggcggtggtttgaagct |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
37212641 |
ttagcagcgaccagtttcttccgttgtggacatcgaggaccgtagatcccggagaagaaggaagggaaaccatcggcagagacggcggtggtttgaggct |
37212740 |
T |
 |
| Q |
122 |
gatcggaaggtggaggcggcggtggtgaggctggtggacggtagattgagatctgagagagggagttgagacggtgagatctggcggttatctttgagtc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37212741 |
gatcggaaggtggaggcggcggtggtgaggctggtggacggtagattgagatctgagagagggagttgagacggtgagatctggcggttatctttgagtc |
37212840 |
T |
 |
| Q |
222 |
gcggaggcgagctagggttcctggtttcaggaatttgtggaagttgtttggtaaagtaggtcttgttctctgct |
295 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37212841 |
gcggaggcgagctagggttcctggtttgaggaatttgtggaagtggtttggtaaagtaggtcttgttctctgct |
37212914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University