View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7686_low_13 (Length: 258)
Name: NF7686_low_13
Description: NF7686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7686_low_13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 258
Target Start/End: Original strand, 47782612 - 47782853
Alignment:
| Q |
18 |
aatttatatgtacctgtgagctctttgaactttatcttcactattgatagnnnnnnnntacttgagagaatccatttcagggtgacaccacaatgaatac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47782612 |
aatttatatgtacctgtgagctctttgaactttatcttcactattgatagaaaaaaaatacttgagagaatccatttcagggtgacaccacaatgaatac |
47782711 |
T |
 |
| Q |
118 |
atttcctatcaccgaagtatgtggaactcttaatagtctctctcctatgacttcc-ttattattttcctacatcgacttcatagtttgttaagcatgaaa |
216 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47782712 |
atttcctatcaccaaagtatgtggaactcttaatagtctctctcctatgacttccttttttattttcctacatcgacttcatagtttgttaagcatgaaa |
47782811 |
T |
 |
| Q |
217 |
tgcgagatagccttcacaatgaaaagctagtttaatttctaa |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47782812 |
tgcgagatagccttcacaatgaaaagctagtttaatttctaa |
47782853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University