View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7686_low_15 (Length: 242)
Name: NF7686_low_15
Description: NF7686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7686_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 232
Target Start/End: Complemental strand, 26489908 - 26489695
Alignment:
| Q |
19 |
aattagtgttggattttatacttaacaaattgtcttgtgatgaattcaaattaatcttgtatttattttattgcttaatttgtcatttaggaataaagct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
26489908 |
aattagtgttggattttatacttaacaaattgtcttgtgatgaattcaaattaatcttgtatttattttgttgcttaatttgtcatctaggaataaagct |
26489809 |
T |
 |
| Q |
119 |
tttatcaaaccttatttaagggaaaatcattgtacgagatgcaaacttgttacatcattttaaagatagtttgtgttcctaaagagggtttgtcttcccc |
218 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26489808 |
tttaccaaaccttatttaagggaaaatcattgtacgagatgcaaacttgttacatcattttaaagatagtttgtgttcctaaagagggtttgtcttcccc |
26489709 |
T |
 |
| Q |
219 |
aaagtatattcttc |
232 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
26489708 |
aaagcatattcttc |
26489695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University