View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7686_low_16 (Length: 239)
Name: NF7686_low_16
Description: NF7686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7686_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 22 - 226
Target Start/End: Complemental strand, 35485270 - 35485066
Alignment:
| Q |
22 |
ttattcccctaaaaatatcaactattcacttattgttctaacaagctcaataattctttttgagataagtttagggttagttagtggtgtttctatgcaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35485270 |
ttattcccctaaaaatatcaactattcacttattgttctaacaagctcaataattctttttgagataagtttagggttagttagtggtgtttctatgcaa |
35485171 |
T |
|
| Q |
122 |
ggtagtgaaaaccttatagctcaagcagctctatttatatttatcttcctcagagaatcaattgaacagagaaaaattgttcagtttgatttttgaaata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35485170 |
ggtagtgaaaaccttatagctcaagcagctctatttatatttatcttcctcagagaatcaattgaacagagaaaaattgttcagtttgatttttgaaata |
35485071 |
T |
|
| Q |
222 |
ttctt |
226 |
Q |
| |
|
||||| |
|
|
| T |
35485070 |
ttctt |
35485066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University