View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7686_low_4 (Length: 443)

Name: NF7686_low_4
Description: NF7686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7686_low_4
NF7686_low_4
[»] chr3 (3 HSPs)
chr3 (14-232)||(9738793-9739010)
chr3 (109-293)||(46016436-46016619)
chr3 (287-396)||(35529153-35529262)
[»] chr7 (1 HSPs)
chr7 (232-378)||(5460698-5460844)
[»] chr1 (2 HSPs)
chr1 (231-362)||(4631200-4631331)
chr1 (254-307)||(8237136-8237189)
[»] chr5 (1 HSPs)
chr5 (300-378)||(26917249-26917327)
[»] chr2 (1 HSPs)
chr2 (338-426)||(24588653-24588741)


Alignment Details
Target: chr3 (Bit Score: 179; Significance: 2e-96; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 9739010 - 9738793
Alignment:
14 atatggcacgcataaccctattgcaatggaagccagcttgcgcaaaggagggctatggcgaaggagaagagctgaataacagtgggacttctcgtcatga 113  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||| |||||||| |||||||||||||||||    
9739010 atatggcacgcataaccctattgcaatggtagccagcttgcgcaaaggagggccacggcgaaggagaagagctaaataacagcgggacttctcgtcatga 9738911  T
114 acaaagtaaatggaggaaattggcagagggggaggtaaagtgcattattggcacgacaattttcaaggaggaagatttgttatgacattggtatgtgtct 213  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||| |||||||||||||||    
9738910 acaaagtaaatggaggaaactggcagagggggaggtaaagtgcattattggcacgacaattttcaaggaggaag-gttgttatggcattggtatgtgtct 9738812  T
214 tagaggaaggcacacataa 232  Q
    |||||||||||||||||||    
9738811 tagaggaaggcacacataa 9738793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 109 - 293
Target Start/End: Complemental strand, 46016619 - 46016436
Alignment:
109 catgaacaaagtaaatggaggaaattggcagagggggaggtaaagtgcattattggcacgacaattttcaaggaggaa-gatttgttatgacattggtat 207  Q
    ||||||||||||| | |||||||||||| ||||||| ||||||||||||| ||     |||||||||||||||||||| |||  |||||| |||| | ||    
46016619 catgaacaaagtagaaggaggaaattggaagaggggaaggtaaagtgcatgatcaatgcgacaattttcaaggaggaatgat--gttatggcattagcat 46016522  T
208 gtgtcttagaggaaggcacacataatatataaaagctaggacgaattggtttcaaggattaccacaacctcacaaggcggaagcaa 293  Q
    ||||||| |||||||||      || |||||||||||||||| | ||||||| ||||||||||||||| |||| ||||||||||||    
46016521 gtgtcttggaggaaggcgtggcaaaaatataaaagctaggacaacttggttttaaggattaccacaacttcacgaggcggaagcaa 46016436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 287 - 396
Target Start/End: Complemental strand, 35529262 - 35529153
Alignment:
287 gaagcaagggcattaaaggaaacgataaaatggtttggtagtttgggtttgtctaatgtgtctcttgaacttgattataagcaagtggttgatgacatca 386  Q
    |||||||| | |||||||||| ||||||| |||||||||||||||| ||||||||| | |||| ||||||||||||| |||||||||||| | ||||||     
35529262 gaagcaagaggattaaaggaagcgataaattggtttggtagtttggatttgtctaacgcgtctattgaacttgattacaagcaagtggttcacgacatcg 35529163  T
387 ctaggagact 396  Q
    ||||||||||    
35529162 ctaggagact 35529153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 232 - 378
Target Start/End: Original strand, 5460698 - 5460844
Alignment:
232 atatataaaagctaggacgaattggtttcaaggattaccacaacctcacaaggcggaagcaagggcattaaaggaaacgataaaatggtttggtagtttg 331  Q
    |||||||||||||||||| | |||||||| ||||||||||||| ||||||||||||||||||    |||||||||| ||||||| ||| ||||||| |||    
5460698 atatataaaagctaggacaacttggtttctaggattaccacaatctcacaaggcggaagcaaaatgattaaaggaagcgataaagtggcttggtagcttg 5460797  T
332 ggtttgtctaatgtgtctcttgaacttgattataagcaagtggttga 378  Q
    |||||||||||||||||| |  || ||||||  ||||||||||||||    
5460798 ggtttgtctaatgtgtctatcaaaattgattgcaagcaagtggttga 5460844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 231 - 362
Target Start/End: Complemental strand, 4631331 - 4631200
Alignment:
231 aatatataaaagctaggacgaattggtttcaaggattaccacaacctcacaaggcgg-aagcaagggcattaaaggaaacgataaaatggtttggtagtt 329  Q
    ||||||||||||||| ||| | ||| ||||||||||| ||||||  |||| |||||| ||| ||| | |||||||||| | ||||| ||| |||||||||    
4631331 aatatataaaagctatgacaacttgatttcaaggattgccacaatatcacgaggcggaaagtaagag-attaaaggaagcaataaattggcttggtagtt 4631233  T
330 tgggtttgtctaatgtgtctcttgaacttgatt 362  Q
    | ||||| ||||| |||||| |  |||||||||    
4631232 taggtttttctaacgtgtctatcaaacttgatt 4631200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 254 - 307
Target Start/End: Original strand, 8237136 - 8237189
Alignment:
254 tggtttcaaggattaccacaacctcacaaggcggaagcaagggcattaaaggaa 307  Q
    ||||||||||| ||||||||||||||  |||||||| |||||| ||||||||||    
8237136 tggtttcaaggtttaccacaacctcatgaggcggaaacaaggggattaaaggaa 8237189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 300 - 378
Target Start/End: Original strand, 26917249 - 26917327
Alignment:
300 taaaggaaacgataaaatggtttggtagtttgggtttgtctaatgtgtctcttgaacttgattataagcaagtggttga 378  Q
    ||||||| ||||||||||||||||| ||| ||||| | |||||  ||||| | ||||||||||  ||||||||||||||    
26917249 taaaggagacgataaaatggtttggaagtatgggtctatctaagatgtctatcgaacttgattgcaagcaagtggttga 26917327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 338 - 426
Target Start/End: Complemental strand, 24588741 - 24588653
Alignment:
338 tctaatgtgtctcttgaacttgattataagcaagtggttgatgacatcactaggagacttagctcatattccatgttcggctctattct 426  Q
    ||||| |||||| | ||||||||||  |||||||||||||| ||||| |||||| |||| | | |  |||||||||| ||| |||||||    
24588741 tctaaggtgtctatcgaacttgattgcaagcaagtggttgacgacataactaggggactcaacaccaattccatgtttggcgctattct 24588653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University