View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7687_high_32 (Length: 226)

Name: NF7687_high_32
Description: NF7687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7687_high_32
NF7687_high_32
[»] chr5 (1 HSPs)
chr5 (81-210)||(26400671-26400801)


Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 81 - 210
Target Start/End: Original strand, 26400671 - 26400801
Alignment:
81 acctcttttcgatcttataagtta-agagctattttcttaagggggtaagttagagttatttacttacgataaaccatatgctttttatgtgattagacc 179  Q
    ||||||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
26400671 acctcttttcgatcttacaagttagagagttattttcttaagggggtaagttagagttatttacttacgataaaccatatgctttttatgtgactagacc 26400770  T
180 aataaaatacattaataaatcatgacaaaaa 210  Q
    |||||||||||||||||||||||||||||||    
26400771 aataaaatacattaataaatcatgacaaaaa 26400801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University