View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7687_low_13 (Length: 359)
Name: NF7687_low_13
Description: NF7687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7687_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 343
Target Start/End: Complemental strand, 41120880 - 41120539
Alignment:
| Q |
1 |
aaatgtgtaagttggttagggggacgaggaaggtggttggaagtggcaaaggaggtgattagctttggaggaggagcagataagggagtgcggcataata |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41120880 |
aaatgtgtaagttggttaggggaacgaggaaggtggttggaagtggcaaaggaggtgattagctttggaggaggagcagataagggagtgcggcata--- |
41120784 |
T |
 |
| Q |
101 |
ttattatgtaacnnnnnnnngc--aggatggtgtggaagacaaatgggattgaaatatagatcctaacaaaggttactttgtttgaggtgtctatcatat |
198 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41120783 |
ttattatctaacttttttttttttaggatggtgtggaagacaaatgggattgaaatatagatcctaataaaggttactttgtttgaggtgtctatcatat |
41120684 |
T |
 |
| Q |
199 |
gttgtcttctgtggagtagattaatcgatatgacatctatgatttagtttggaacaaagtgtctcttttaaaggtttctttgttcgcttgacggttgtta |
298 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41120683 |
gttgtcttctgtggagcagattaatcgatatgacatctatgatttagtttggaacaaagtgtctcttttaaaggtttctttgttcgcttgacggttgtta |
41120584 |
T |
 |
| Q |
299 |
ctaaaccgcttaacaacaaaagataatatgatttgtcgtggaatt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41120583 |
ctaaaccgcttaacaacaaaagataatatgatttgtcgtggaatt |
41120539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University