View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7687_low_23 (Length: 298)
Name: NF7687_low_23
Description: NF7687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7687_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 41 - 231
Target Start/End: Complemental strand, 1604023 - 1603833
Alignment:
| Q |
41 |
gcaacacaaaccagaaatattggttaggcacgtgcgtagggtagaactaaatgcaaccggacacgtgtcagtccctaaaagcaaaactgattgtgaacca |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1604023 |
gcaacacaaaccagaaatattggttaggcacgtgcgtagggtagaactaaatgcaaccggacacgtgtcagtccctaaaagcaaaactgattgtggacca |
1603924 |
T |
 |
| Q |
141 |
atagaaatacagtaactgatcggatcttaaacacccacctcccaaccacgaacaatatttccatgccacgtgtcggtttctccgtcatacc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1603923 |
atagaaatacagtaactgatcggatcttaaacactcacctcccaaccacgaacaatatttccatgccacgtgtcggtttctccgtcatacc |
1603833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University