View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7687_low_26 (Length: 294)
Name: NF7687_low_26
Description: NF7687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7687_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 82 - 282
Target Start/End: Original strand, 14666136 - 14666333
Alignment:
| Q |
82 |
catttcaacccaaaacaataattacataaacaaacaaattatgatacgcataaataaaaactaaaggtgaatctcaggaatttttatgttgaataatttg |
181 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
14666136 |
catttcaacccaaaataataattacataaacaaacaaat---gattggcataaataaaacctaaaggtgaatctcaagattttttatgttgaataatttg |
14666232 |
T |
 |
| Q |
182 |
aaaggatggaaaagaatatgcaaaaggagtatttatcattgtgtaactaacctgtaagatgaaataatgaggtgcagtcaatgtccataaggatcgagta |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| | | |||||||||||||||| || |||||||||| |||| ||||| |
|
|
| T |
14666233 |
aaaggatggaaaagaatatgcaaaaggagtatttttcattgtgtaactaacctctgaaatgaaataatgaggtgaagcaaatgtccatacggattgagta |
14666332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University