View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7687_low_35 (Length: 226)
Name: NF7687_low_35
Description: NF7687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7687_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 81 - 210
Target Start/End: Original strand, 26400671 - 26400801
Alignment:
| Q |
81 |
acctcttttcgatcttataagtta-agagctattttcttaagggggtaagttagagttatttacttacgataaaccatatgctttttatgtgattagacc |
179 |
Q |
| |
|
||||||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26400671 |
acctcttttcgatcttacaagttagagagttattttcttaagggggtaagttagagttatttacttacgataaaccatatgctttttatgtgactagacc |
26400770 |
T |
 |
| Q |
180 |
aataaaatacattaataaatcatgacaaaaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26400771 |
aataaaatacattaataaatcatgacaaaaa |
26400801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University