View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7687_low_36 (Length: 203)
Name: NF7687_low_36
Description: NF7687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7687_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 14 - 188
Target Start/End: Complemental strand, 10836078 - 10835904
Alignment:
| Q |
14 |
agaatatagggcaaagtgatgaggttattgatgagaagaaattgaagaccataaccaacaagacccattgaagcagcaataaacatgacaagagagattg |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10836078 |
agaaaatagggcaaagtgatgaggttattgatgagaagaaattgaagaccataaccaacaagacccattgaagcagcaataaacatgacaagagagattg |
10835979 |
T |
|
| Q |
114 |
gaagatacataagagcaagaccagaagaccaaccaaacactttacccatgtcacttgcagttgctaagtagttaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10835978 |
gaagatacataagagcaagaccagaagaccaaccaaacactttacccatgtcacttgcagttgctaagtagttaa |
10835904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University