View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7687_low_36 (Length: 203)

Name: NF7687_low_36
Description: NF7687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7687_low_36
NF7687_low_36
[»] chr5 (1 HSPs)
chr5 (14-188)||(10835904-10836078)


Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 14 - 188
Target Start/End: Complemental strand, 10836078 - 10835904
Alignment:
14 agaatatagggcaaagtgatgaggttattgatgagaagaaattgaagaccataaccaacaagacccattgaagcagcaataaacatgacaagagagattg 113  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10836078 agaaaatagggcaaagtgatgaggttattgatgagaagaaattgaagaccataaccaacaagacccattgaagcagcaataaacatgacaagagagattg 10835979  T
114 gaagatacataagagcaagaccagaagaccaaccaaacactttacccatgtcacttgcagttgctaagtagttaa 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10835978 gaagatacataagagcaagaccagaagaccaaccaaacactttacccatgtcacttgcagttgctaagtagttaa 10835904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University