View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7688_high_3 (Length: 385)
Name: NF7688_high_3
Description: NF7688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7688_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 177 - 377
Target Start/End: Original strand, 42141481 - 42141681
Alignment:
| Q |
177 |
acagatttcgatgaatctggagattttggagcaaatacaatttcatcggattcagcttttctacttctcttcctcagaaattgagcagaatcaatttcat |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42141481 |
acagatttcgatgaatctggagattttggagcaaatacaatttcatcagattcagcttttctacttctcttcctcagaaattgagcagaatcaatttcat |
42141580 |
T |
|
| Q |
277 |
tttctactttaattgaactgttatgagttacagctttttcttttcgagtgaaatcaagacgagatttcgcggccggaacagaattctccccgattcttct |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42141581 |
tttctactttaattgaactgttatgagttacagctttttcttttcgagtgaaatcaagacgagatttcgcggccggaacagaattctccccgattcttct |
42141680 |
T |
|
| Q |
377 |
c |
377 |
Q |
| |
|
| |
|
|
| T |
42141681 |
c |
42141681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 17 - 113
Target Start/End: Original strand, 42141321 - 42141417
Alignment:
| Q |
17 |
aacaaccattttctcaaccttaacctcgttcttcctctttctcttcttagtttccgattgatccggcgacgtcggagcgaacgaaaccttaacggaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42141321 |
aacaaccattttctcaaccttaacctcgttcttcctctttctcttcttagtttccgattgatccggcgatgtcggagcgaacgaaaccttaacggaa |
42141417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 17 - 71
Target Start/End: Original strand, 23660289 - 23660343
Alignment:
| Q |
17 |
aacaaccattttctcaaccttaacctcgttcttcctctttctcttcttagtttcc |
71 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23660289 |
aacaaccgttttctcaacactaacctcgttcttcctctttctcttcttagtttcc |
23660343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University