View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7688_high_5 (Length: 324)
Name: NF7688_high_5
Description: NF7688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7688_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 7 - 307
Target Start/End: Original strand, 12312086 - 12312388
Alignment:
| Q |
7 |
tttggtgttgtattataacctcatctttcagcttctgtatatgctattgagtttgaaaggttcaaggaagagatcaaaactgaactcgctgctcaaagtg |
106 |
Q |
| |
|
|||| |||||| ||| |||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12312086 |
tttgttgttgtgttacaacctcatcttttagcttatgtatatgccattgagtttgaaaggttcaaggaagagatcaaaactgaactcgctgctcaaagtg |
12312185 |
T |
|
| Q |
107 |
ctaagatttatgagaaactgtccgctcagtctgttaagcaagaaaaaactgatgaaaatgtaaacctactaatcagactttccactaaggatatcaaata |
206 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12312186 |
ctaggatttatgagaaactgtccgctcagtctgttaagcaagaaaaaactgatgaaaatgaaaacctactaatcagactttccactaaagatatcaaata |
12312285 |
T |
|
| Q |
207 |
cccttaggaaccccatttatcttgcatgtgacacaatttttgtctatgacagtagccaactctttgatttctttgttc--attgctccattttttctcac |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| | ||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
12312286 |
cccttaggaaccccatttatcttgcatgtggcacaatttttgtctatggcagtagccgattctttgatttcttcattcatattgctccattttttctcac |
12312385 |
T |
|
| Q |
305 |
cat |
307 |
Q |
| |
|
||| |
|
|
| T |
12312386 |
cat |
12312388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University