View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7688_low_14 (Length: 309)
Name: NF7688_low_14
Description: NF7688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7688_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 13 - 205
Target Start/End: Original strand, 34143956 - 34144148
Alignment:
| Q |
13 |
aatatagggctctgtggctctgtggacgcaccaaatgcacatgaaacatgttttcctttaaatatcgcggcttgatcacttcctaaaaatgagccaatgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34143956 |
aatatagggctctgtggctctgtggacgcaccaaatgcacatgaaacatgatttcctttaaatatcgcggcttgatcacttcctaaaaatgagccaatgt |
34144055 |
T |
 |
| Q |
113 |
gatgnnnnnnnnnnnnnnnnccaactgtaggaaatcatcgcacgtattacaagaaattggatatcttgaacaatctttaacaaccttatccca |
205 |
Q |
| |
|
||| ||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
34144056 |
aatgaaaaaataataaaaaaccaactgtaggaaatcatcacacgtattacaagaaattggctatcttgaactatctttaacaaacttatccca |
34144148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 230 - 290
Target Start/End: Original strand, 34144167 - 34144227
Alignment:
| Q |
230 |
gttattgtataaattatggtacctaaactctcggtgacttggctatcttgaacttgactcc |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34144167 |
gttattgtataaattatggtacctaaactctcggtgacttggctatcttgaacttgactcc |
34144227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University