View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7688_low_26 (Length: 223)
Name: NF7688_low_26
Description: NF7688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7688_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 49163821 - 49163627
Alignment:
| Q |
18 |
caaatatatgaaaactaaccccacactaggagactacacacacactatcctctga--aaaccgttgggcttttcttgctgttgtgtcgctttctaatctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49163821 |
caaatatatgaaaactaaccccacactaggagtctactcacacactatcctctgagaaaaccgttgggcttttcttgctgttgtgtcgctttctaatctt |
49163722 |
T |
 |
| Q |
116 |
caattgcatatagactcttgtaattggattagggcagtaggttctacagnnnnnnnaccccaacccttcatcatttattcatgtatatctctgct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49163721 |
caattgcatatagactcttgtaattggattagggcagtaggtgctacagcccccccaccccaacccttcatcatttattcatgtatatctttgct |
49163627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University