View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7689_high_3 (Length: 508)
Name: NF7689_high_3
Description: NF7689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7689_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 7e-81; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 7e-81
Query Start/End: Original strand, 15 - 171
Target Start/End: Complemental strand, 28961183 - 28961027
Alignment:
| Q |
15 |
gagaagaagagggcagttctgtcatttcacaatgcatacaccattgactctgaccagttgattgagttcaaacttgaaaaagttgagacttttgatactg |
114 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28961183 |
gagaagaagagggcagttatgtcatttcacaatgcatacaccattgactctgaccagttgattgagttcaaacttgaaaaagttgagacttttgatactg |
28961084 |
T |
 |
| Q |
115 |
aaaagtttaaagaaagcatgaaagaatccaattgctttgatatgaggcatgcacgca |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28961083 |
aaaagtttaaagaaagcatgaaagaatccaattgctttgatatgaggcatgcacgca |
28961027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 253 - 416
Target Start/End: Complemental strand, 28960917 - 28960754
Alignment:
| Q |
253 |
tgtggcttctccaaaattacaacggatcaccgtgattctgacacatctatcgtgatatcaaatatacattgggtcagggcaaaaccaactaggtatgaaa |
352 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
28960917 |
tgtggcttctccaaaattacaatggatcaccgtgattctgacatatctatcgtgatatcaaatatacatcaagtcagagcaaaaccaactaggtatgaaa |
28960818 |
T |
 |
| Q |
353 |
aatgcaggaggaggaaggtgttaccttaagaatgacacgaggcttgtagcttttactagcaccc |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28960817 |
aatgcaggaggaggaaggtgttaccttaagaatgacacgaggcttgtagcttttactagcaccc |
28960754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 236 - 274
Target Start/End: Complemental strand, 28960956 - 28960918
Alignment:
| Q |
236 |
caatgtaacatctgctttgtggcttctccaaaattacaa |
274 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28960956 |
caatgtaacatctactttgtggcttctccaaaattacaa |
28960918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 257 - 320
Target Start/End: Complemental strand, 33944816 - 33944753
Alignment:
| Q |
257 |
gcttctccaaaattacaacggatcaccgtgattctgacacatctatcgtgatatcaaatataca |
320 |
Q |
| |
|
|||||| |||||| || | |||||||||||||||| ||||||| | |||||||||||| ||||| |
|
|
| T |
33944816 |
gcttctgcaaaatcacgatggatcaccgtgattctaacacatccaccgtgatatcaaacataca |
33944753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University