View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7689_high_38 (Length: 211)
Name: NF7689_high_38
Description: NF7689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7689_high_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 26 - 172
Target Start/End: Original strand, 23283920 - 23284068
Alignment:
| Q |
26 |
gagttggggttacgagagtgaagagtatgttgttata--tatatacggaagcatggttgggtttatttgaagagtgtaagtgtgtgtgtttcgtgtgagt |
123 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23283920 |
gagttggtgttacgagagtgaagagtatgttgttatatatatatacggaagcatggttgggtttatttgaagagtgtaagtgtgtgtgtttcgtgtgagt |
23284019 |
T |
 |
| Q |
124 |
tggatattttagaattgtaaactgtttaagaagccaggtggttggttat |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23284020 |
tggatattttagaattgtaaactgtttaagaagccaggtggttggttat |
23284068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 118 - 168
Target Start/End: Original strand, 23290349 - 23290398
Alignment:
| Q |
118 |
gtgagttggatattttagaattgtaaactgtttaagaagccaggtggttgg |
168 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
23290349 |
gtgatttggatattttagaattgt-aactgtgtaagaagccaggtggttgg |
23290398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University