View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7689_low_31 (Length: 300)
Name: NF7689_low_31
Description: NF7689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7689_low_31 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 138 - 300
Target Start/End: Original strand, 5397219 - 5397383
Alignment:
| Q |
138 |
atttacttttaaattttagattttaagattgagccctacttactattacaaattactctctccagtttaatttatacataagaggtatttcaatctac-- |
235 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||| |
|
|
| T |
5397219 |
atttatttttaaattttagattttaagattgagccctacttactattacaaattactctctccagtttaatttatacataatagatatttcggtctacaa |
5397318 |
T |
|
| Q |
236 |
aaaagttcatatatctcattcaaattggatcaaatagataacttttattgacttaaatacctctt |
300 |
Q |
| |
|
||||||| |||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
5397319 |
aaaagtttatatatctgattcaaattggattaaatagataatttttattgacttaaatacctctt |
5397383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 11 - 94
Target Start/End: Original strand, 5397140 - 5397223
Alignment:
| Q |
11 |
tgggacggtcacaaatttatctggcttttagaatttttgtaacaatcctatatgtagtaactctgttattatttaaaaaattta |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5397140 |
tgggacggtcacaaatttatctggcttttagaatatttgtaacaatcctatatgtagtaactctgttattatttaaaaaattta |
5397223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University