View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7689_low_35 (Length: 261)
Name: NF7689_low_35
Description: NF7689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7689_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 1173087 - 1172858
Alignment:
| Q |
18 |
cgaagttgcttatttattatgttatttaaaaatgacataacaaacttgccctacgcgtaaatcctactataatgattggtgctatgaagttgctttattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1173087 |
cgaagttgcttatttattatgttatttaaaaatgacataacaaacttgccctacgcgtaaatcctactataatggatggtgctatgaagttgctttattt |
1172988 |
T |
 |
| Q |
118 |
ctttggtaacacttcatataaatacctcaaccctactt--gaaggaatacatacatcttcttgagggaaacaaaaagagtcaatcgatattgagagttat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| ||||||||| || ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1172987 |
ctttggtaacacttcatataaatacctcaaccctacttaagaacgaatacataaatgttcttgagggaaacaaaaagagtcagtcgatattgagagttat |
1172888 |
T |
 |
| Q |
216 |
aatcgtcgtttgcttgttattcagaattct |
245 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
1172887 |
aatcgtcgtttgcttgttattcacaattct |
1172858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University