View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7689_low_38 (Length: 252)
Name: NF7689_low_38
Description: NF7689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7689_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 39069495 - 39069623
Alignment:
| Q |
1 |
ctactacgtaacaagatgttgataaattaagaggacttttacttgtaacgtgtggaattaaaatgttatccagtccaagcaataaaacattttattgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39069495 |
ctactacgtaacaagatgttgataaattaagaggacttttacttgtaacgtgtggaattaaaatgttatccagtccaagcaataaaacattttattgttg |
39069594 |
T |
 |
| Q |
101 |
ttgtaatacgctgtgttgcagtggttatg |
129 |
Q |
| |
|
|||||||||| ||||||| |||||||||| |
|
|
| T |
39069595 |
ttgtaatacgttgtgttgtagtggttatg |
39069623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 196 - 245
Target Start/End: Original strand, 39070533 - 39070582
Alignment:
| Q |
196 |
ttttgcttatgtttggtgatttaaatgagccagcttatatattattcgac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39070533 |
ttttgcttatgtttggtgatttaaatgagccagcttatatcttattcgac |
39070582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 103 - 140
Target Start/End: Complemental strand, 16967361 - 16967324
Alignment:
| Q |
103 |
gtaatacgctgtgttgcagtggttatgtgttctctcaa |
140 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
16967361 |
gtaatacgttgtgttgcagtagttatgtgttctctcaa |
16967324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University