View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7689_low_48 (Length: 202)
Name: NF7689_low_48
Description: NF7689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7689_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 21 - 190
Target Start/End: Original strand, 40286645 - 40286814
Alignment:
| Q |
21 |
tgtcattctagattcttcgcgaataaattcttctacttgtttttgaatgcatgattttcattaatcaatgaacgttgattgaacaaaaactccaaattca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40286645 |
tgtcattctagattcttcgcgaataaattcttctacttgtttttgaatgcatgattttcattaatcaatgaacgttgattgaacaaaaactccaaattca |
40286744 |
T |
|
| Q |
121 |
aagcaaaatctgtgactgcatatttgtataagtgatgcactttctgtctttttatcaaaaatttcatctc |
190 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40286745 |
aagcaaaatctgtgactgcatatttttataagtgatgcactttctgtctttttatcaaaaacttcatctc |
40286814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 21 - 147
Target Start/End: Complemental strand, 40456115 - 40455989
Alignment:
| Q |
21 |
tgtcattctagattcttcgcgaataaattcttctacttgtttttgaatgcatgattttcattaatcaatgaacgttgattgaacaaaaactccaaattca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| ||| ||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
40456115 |
tgtcattctagattcttcgcgaataaattcttctacttgtttttggatgtatgattttgattgatcaatgaatgttgatggaacaaaaactccaaattca |
40456016 |
T |
|
| Q |
121 |
aagcaaaatctgtgactgcatatttgt |
147 |
Q |
| |
|
|| |||||||| | ||||||||||||| |
|
|
| T |
40456015 |
aaacaaaatcttttactgcatatttgt |
40455989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University