View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7690_high_16 (Length: 213)

Name: NF7690_high_16
Description: NF7690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7690_high_16
NF7690_high_16
[»] chr5 (1 HSPs)
chr5 (70-192)||(32556631-32556753)


Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 70 - 192
Target Start/End: Original strand, 32556631 - 32556753
Alignment:
70 aagacgtcgtagactcataaatccatcgaaaatagaccaagactaacatgagctaccataacaaaagatgttctataatagaccttttttatggaatcaa 169  Q
    |||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
32556631 aagatgtcatagactcataaatccatcgaaaatagaccaagactaacatcagctaccataacaaaagatgttctataatagaccttttttatggaatcaa 32556730  T
170 ataaaccatgtgtttactacagt 192  Q
    |||||||||||||||||||||||    
32556731 ataaaccatgtgtttactacagt 32556753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University