View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7690_high_16 (Length: 213)
Name: NF7690_high_16
Description: NF7690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7690_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 70 - 192
Target Start/End: Original strand, 32556631 - 32556753
Alignment:
| Q |
70 |
aagacgtcgtagactcataaatccatcgaaaatagaccaagactaacatgagctaccataacaaaagatgttctataatagaccttttttatggaatcaa |
169 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32556631 |
aagatgtcatagactcataaatccatcgaaaatagaccaagactaacatcagctaccataacaaaagatgttctataatagaccttttttatggaatcaa |
32556730 |
T |
 |
| Q |
170 |
ataaaccatgtgtttactacagt |
192 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32556731 |
ataaaccatgtgtttactacagt |
32556753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University