View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7690_high_8 (Length: 260)
Name: NF7690_high_8
Description: NF7690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7690_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 19 - 245
Target Start/End: Original strand, 38943803 - 38944038
Alignment:
| Q |
19 |
aatcccaacctcgatttctatctcatgttattcaaactcattatctagaaggtagaaaatgaaaataaa---------agtctccatgaaattgaatgct |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
38943803 |
aatcccaacctcgatttctatctcatgttattcaaactcattatctataaggtagaaaatgaaaacaaagatataataagtctccatgaaattcaatgct |
38943902 |
T |
 |
| Q |
110 |
agttataaattataaataaatagataaatcaaataagctgaaatcatcactttagggaaatcactttaaagtatttatcaaataagctagttataatact |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38943903 |
agttataaattataaataaatagataaatcaaataagctgaagtcatcactttagagaaatcattttaaagtgtttatcaaataagctagttataatact |
38944002 |
T |
 |
| Q |
210 |
tcatcacacttgtttgcaaagctcttgagtttggtt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38944003 |
ccatcacacttgtttgcaaagctcttgagtttggtt |
38944038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University