View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7691_high_18 (Length: 276)
Name: NF7691_high_18
Description: NF7691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7691_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 157 - 257
Target Start/End: Complemental strand, 39725770 - 39725670
Alignment:
| Q |
157 |
cttttaatgataaaggtggcaaaatgagtaagaagaacgaaaatggtgataagagcaatcatgttttgaaacacttagttggtatacgaggtggtttgtt |
256 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39725770 |
cttttaatgataaaagtggcaaaatgagtaagaagaacgaaaatggtgataagagcaatcatgttttgaaaaacttagttggtatacgaggtggtttgtt |
39725671 |
T |
|
| Q |
257 |
g |
257 |
Q |
| |
|
| |
|
|
| T |
39725670 |
g |
39725670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 39725923 - 39725837
Alignment:
| Q |
1 |
ctcaaagtagaaaatcatcggtttgggaaattttccgtttaggtgttgtccctactccagaaataggattgcaagacctcaaggttc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39725923 |
ctcaaagtagaaaatcatcggtttgggaaattttccgtttaggtgttgtccctactccagaaataggattgcaagacctcaaggttc |
39725837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University