View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7691_high_20 (Length: 258)
Name: NF7691_high_20
Description: NF7691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7691_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 4190407 - 4190173
Alignment:
| Q |
1 |
atttcaattctagaagtgaataacnnnnnnncaatgaaaataagagtgtttaattttcattttgattaacaaagattattgttctttgacttaatttgca |
100 |
Q |
| |
|
||||||||||||| ||| |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4190407 |
atttcaattctagcagtaaataacacaaaaacaatgaaaataag--tgtttaattttcattttgattaacaaagattattgttctttgacttaatttgca |
4190310 |
T |
 |
| Q |
101 |
ggtaagttgacatcagatgcagctcttgatccagcagggttactagcagttgctgtttgccatggttttgcactttttgttgctgttgcagttggtgcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4190309 |
ggtaagttgacatcagatgcagctcttgatccagcagggttactagcagttgctgtttgccatggttttgcactttttgttgctgttgcagttggtgcca |
4190210 |
T |
 |
| Q |
201 |
acatttctggtggtcatgtcaaccctgctgtcacctt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4190209 |
acatttctggtggtcatgtcaaccctgctgtcacctt |
4190173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 95 - 237
Target Start/End: Original strand, 43585120 - 43585262
Alignment:
| Q |
95 |
tttgcaggtaagttgacatcagatgcagctcttgatccagcagggttactagcagttgctgtttgccatggttttgcactttttgttgctgttgcagttg |
194 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||| || || ||| |||||||||||||||| ||||||||||| ||||||||||||||| | |||| |
|
|
| T |
43585120 |
tttgcagctaagttgacatcaggtgcagctcttgatcctgctggattagtagcagttgctgtttgtcatggttttgctctttttgttgctgtttctgttg |
43585219 |
T |
 |
| Q |
195 |
gtgccaacatttctggtggtcatgtcaaccctgctgtcacctt |
237 |
Q |
| |
|
| |||||||| |||||||| ||||||||||| ||||| ||||| |
|
|
| T |
43585220 |
gagccaacatatctggtggacatgtcaacccagctgtgacctt |
43585262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 167 - 234
Target Start/End: Original strand, 23339461 - 23339528
Alignment:
| Q |
167 |
tttgcactttttgttgctgttgcagttggtgccaacatttctggtggtcatgtcaaccctgctgtcac |
234 |
Q |
| |
|
|||||||||||||||||||| | |||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
23339461 |
tttgcactttttgttgctgtctctgttggtgctaacatttctggtggacatgtcaaccctgctgtcac |
23339528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 234
Target Start/End: Complemental strand, 52103130 - 52103072
Alignment:
| Q |
176 |
tttgttgctgttgcagttggtgccaacatttctggtggtcatgtcaaccctgctgtcac |
234 |
Q |
| |
|
||||| |||||| | |||||||| |||||||||||||| ||||| |||||||| ||||| |
|
|
| T |
52103130 |
tttgtggctgtttctgttggtgcaaacatttctggtggacatgtgaaccctgcagtcac |
52103072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 176 - 237
Target Start/End: Complemental strand, 41418521 - 41418460
Alignment:
| Q |
176 |
tttgttgctgttgcagttggtgccaacatttctggtggtcatgtcaaccctgctgtcacctt |
237 |
Q |
| |
|
||||||||||| | |||||||| ||||| || ||||| ||||||||||| ||||||||||| |
|
|
| T |
41418521 |
tttgttgctgtctccgttggtgctaacatctccggtggacatgtcaaccccgctgtcacctt |
41418460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University