View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7691_high_25 (Length: 240)
Name: NF7691_high_25
Description: NF7691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7691_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 223
Target Start/End: Original strand, 32724908 - 32725116
Alignment:
| Q |
17 |
cagttttcaatctatttccatgttcaaattgatgagtattttttggacgtattactggtttatgcggacagcatgattttcattagacacattgtcattt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32724908 |
cagttttcaatctatttccatgttcaaattgatgagtattttttgcacgtattactggtttatgcggacagcatgattttcattagacacattgtcattt |
32725007 |
T |
 |
| Q |
117 |
gttttgaggattgatacttcaaaatgctcttttattaaatgcccctattgtaattgcatagatgttccnnnnnnnnnn--gttatgaatttaaaggtact |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
32725008 |
gttttgaggattgatacttcaaaatgctcttttattaaatgcccctattgtaattgcatagttgttccttttttttttttgttatgaatttaaaggtact |
32725107 |
T |
 |
| Q |
215 |
cacatttat |
223 |
Q |
| |
|
||||||||| |
|
|
| T |
32725108 |
cacatttat |
32725116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University