View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7691_low_23 (Length: 274)
Name: NF7691_low_23
Description: NF7691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7691_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 17 - 263
Target Start/End: Original strand, 37637666 - 37637906
Alignment:
| Q |
17 |
catagattcactacaatttgttttactgatttgtgtgctcaaaacattggtggtaatggtattctccaaacttcttccttgctgttaggtgcttggtctc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37637666 |
catagattcactacaatttgttttactgatttgtgtgctcaaaacattggtggt------attctccgaacttcttccttgctgttaggtgcttggtctc |
37637759 |
T |
 |
| Q |
117 |
aggttattaagcgcaaaattaaaatcgagtttagatgggagagattgcttgttaaagctctctcgaaacttccattgttgaaatgcttctgagctgaata |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37637760 |
aggttattaagcgcaaaattaaaatcgagtttagatgggagagattgcttgttaaggctctctcgaaacttccattgttgaaatgcttctgagctgaata |
37637859 |
T |
 |
| Q |
217 |
ataggttattcctatccattcttgatcattttatgcaaacctttctt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37637860 |
ataggttattcctatccattcttgatcattttatgcaaacctttctt |
37637906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University