View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7691_low_34 (Length: 238)
Name: NF7691_low_34
Description: NF7691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7691_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 136 - 223
Target Start/End: Complemental strand, 51875991 - 51875904
Alignment:
| Q |
136 |
gatattaaataattgaatgttgtattccatacaaaatgaaactctaggtatcgaggtattcatctaattttaatttgacagttcaaat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51875991 |
gatattaaataattgaatgttgtattccatacaaaatgaaactctaggtattgaggtattcatctaattttaatttgacagttcaaat |
51875904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 51876126 - 51876052
Alignment:
| Q |
1 |
taaacacatagtacacttaattttaagaaaattcttaggtggcttgagttttgatggatagcggttctcatgtag |
75 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51876126 |
taaacacatattacacttaattttaagaaaattcttaggtggcttgagttttgatggatagcggttctcatgtag |
51876052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University